Review



api 20e identification kit for enterobacterales detection  (bioMerieux gmbh)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    bioMerieux gmbh api 20e identification kit for enterobacterales detection
    Api 20e Identification Kit For Enterobacterales Detection, supplied by bioMerieux gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/api+20e+identification+kit/api+20+e/pmc12218873-93-12-14
    Average 90 stars, based on 1 article reviews
    api 20e identification kit for enterobacterales detection - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Salmonella enteritidis Effector AvrA Stabilizes Intestinal Tight Junctions via the JNK Pathway
    Article Snippet: Biochemical tests were performed using the API 20E identification kit (bioMerieux SA, Lyon, France) in accordance with the manufacturer's protocol. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′-3′) AvrA-e forward CAGGCCACAAAAGAAAAC AvrA-e reverse ATAACAGCCGCATCAAAC AvrA-r forward CCCAAGCTT ATCTACCTCCCGGTGTCA AvrA-r reverse CGGGATCC TTGCGGGCGTCTATCTGT AvrA-cm forward AGGCAATATATTGAATCTGAAAAGTTAAAGATGATATTT GTGTAGGCTGGAGCTGCTTC AvrA-cm reverse TTTCCTCTGGCAGGCAACCTTATAATTTCATTACGATTT ATGGGAATTAGCCATGGTCC AvrA-q forward AGAGTTATGGACGGAAAGAC AvrA-q reverse AAATACCGCATTCAGAAGAG GMK forward CACTCAGGTTTCCGTTTCA GMK reverse CACTTGCTCAATGGTTTCG mIL-6 forward CTGCAAGAGACTTCCATCCAG mIL-6 reverse AGTGGTATAGACAGGTCTGTTGG hZo-1 reverse TGGTGTCCTACCTAATTCAACTCA hZo-1 forward CGCCAGCTACAA ATATTCCAACA mZo-1 reverse ATCTGGCTCCTCTCTTGCCAACTT mZo-1 forward AGGTCTTCGCAGCTCCAAGAGAAA mTNF-α forward CCCTCACACTCAGATCATCTTCT mTNF-α reverse GCTACGACGTGGGCTACAG Open in a separate window Primers used in this study Cell Culture Human epithelial Caco-2 BBE, HCT116 and SKCO15 cells were maintained in DMEM supplemented with 10% FBS, streptomycin-penicillin, and l -glutamine. .. Biochemical tests were performed using the API 20E identification kit (bioMerieux SA, Lyon, France) in accordance with the manufacturer's protocol. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′-3′) AvrA-e forward CAGGCCACAAAAGAAAAC AvrA-e reverse ATAACAGCCGCATCAAAC AvrA-r forward CCCAAGCTT ATCTACCTCCCGGTGTCA AvrA-r reverse CGGGATCC TTGCGGGCGTCTATCTGT AvrA-cm forward AGGCAATATATTGAATCTGAAAAGTTAAAGATGATATTT GTGTAGGCTGGAGCTGCTTC AvrA-cm reverse TTTCCTCTGGCAGGCAACCTTATAATTTCATTACGATTT ATGGGAATTAGCCATGGTCC AvrA-q forward AGAGTTATGGACGGAAAGAC AvrA-q reverse AAATACCGCATTCAGAAGAG GMK forward CACTCAGGTTTCCGTTTCA GMK reverse CACTTGCTCAATGGTTTCG mIL-6 forward CTGCAAGAGACTTCCATCCAG mIL-6 reverse AGTGGTATAGACAGGTCTGTTGG hZo-1 reverse TGGTGTCCTACCTAATTCAACTCA hZo-1 forward CGCCAGCTACAA ATATTCCAACA mZo-1 reverse ATCTGGCTCCTCTCTTGCCAACTT mZo-1 forward AGGTCTTCGCAGCTCCAAGAGAAA mTNF-α forward CCCTCACACTCAGATCATCTTCT mTNF-α reverse GCTACGACGTGGGCTACAG Open in a separate window Primers used in this study Cell Culture Human epithelial Caco-2 BBE, HCT116 and SKCO15 cells were maintained in DMEM supplemented with 10% FBS, streptomycin-penicillin, and l -glutamine. .. Cell Treatment with the JNK Inhibitor SP600125 The JNK inhibitor SP600125 (50 m m ; EMD Biosciences, San Diego, CA) was added directly to the culture medium 1 h before Salmonella treatment.

    Article Title: Salmonella enteritidis Effector AvrA Stabilizes Intestinal Tight Junctions via the JNK Pathway
    Article Snippet: Biochemical tests were performed using the API 20E identification kit (bioMerieux SA, Lyon, France) in accordance with the manufacturer's protocol. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′-3′) AvrA-e forward CAGGCCACAAAAGAAAAC AvrA-e reverse ATAACAGCCGCATCAAAC AvrA-r forward CCCAAGCTT ATCTACCTCCCGGTGTCA AvrA-r reverse CGGGATCC TTGCGGGCGTCTATCTGT AvrA-cm forward AGGCAATATATTGAATCTGAAAAGTTAAAGATGATATTT GTGTAGGCTGGAGCTGCTTC AvrA-cm reverse TTTCCTCTGGCAGGCAACCTTATAATTTCATTACGATTT ATGGGAATTAGCCATGGTCC AvrA-q forward AGAGTTATGGACGGAAAGAC AvrA-q reverse AAATACCGCATTCAGAAGAG GMK forward CACTCAGGTTTCCGTTTCA GMK reverse CACTTGCTCAATGGTTTCG mIL-6 forward CTGCAAGAGACTTCCATCCAG mIL-6 reverse AGTGGTATAGACAGGTCTGTTGG hZo-1 reverse TGGTGTCCTACCTAATTCAACTCA hZo-1 forward CGCCAGCTACAA ATATTCCAACA mZo-1 reverse ATCTGGCTCCTCTCTTGCCAACTT mZo-1 forward AGGTCTTCGCAGCTCCAAGAGAAA mTNF-α forward CCCTCACACTCAGATCATCTTCT mTNF-α reverse GCTACGACGTGGGCTACAG Open in a separate window Primers used in this study .. Biochemical tests were performed using the API 20E identification kit (bioMerieux SA, Lyon, France) in accordance with the manufacturer's protocol. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′-3′) AvrA-e forward CAGGCCACAAAAGAAAAC AvrA-e reverse ATAACAGCCGCATCAAAC AvrA-r forward CCCAAGCTT ATCTACCTCCCGGTGTCA AvrA-r reverse CGGGATCC TTGCGGGCGTCTATCTGT AvrA-cm forward AGGCAATATATTGAATCTGAAAAGTTAAAGATGATATTT GTGTAGGCTGGAGCTGCTTC AvrA-cm reverse TTTCCTCTGGCAGGCAACCTTATAATTTCATTACGATTT ATGGGAATTAGCCATGGTCC AvrA-q forward AGAGTTATGGACGGAAAGAC AvrA-q reverse AAATACCGCATTCAGAAGAG GMK forward CACTCAGGTTTCCGTTTCA GMK reverse CACTTGCTCAATGGTTTCG mIL-6 forward CTGCAAGAGACTTCCATCCAG mIL-6 reverse AGTGGTATAGACAGGTCTGTTGG hZo-1 reverse TGGTGTCCTACCTAATTCAACTCA hZo-1 forward CGCCAGCTACAA ATATTCCAACA mZo-1 reverse ATCTGGCTCCTCTCTTGCCAACTT mZo-1 forward AGGTCTTCGCAGCTCCAAGAGAAA mTNF-α forward CCCTCACACTCAGATCATCTTCT mTNF-α reverse GCTACGACGTGGGCTACAG Open in a separate window Primers used in this study ..

    Cell Culture:

    Article Title: Salmonella enteritidis Effector AvrA Stabilizes Intestinal Tight Junctions via the JNK Pathway
    Article Snippet: Biochemical tests were performed using the API 20E identification kit (bioMerieux SA, Lyon, France) in accordance with the manufacturer's protocol. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′-3′) AvrA-e forward CAGGCCACAAAAGAAAAC AvrA-e reverse ATAACAGCCGCATCAAAC AvrA-r forward CCCAAGCTT ATCTACCTCCCGGTGTCA AvrA-r reverse CGGGATCC TTGCGGGCGTCTATCTGT AvrA-cm forward AGGCAATATATTGAATCTGAAAAGTTAAAGATGATATTT GTGTAGGCTGGAGCTGCTTC AvrA-cm reverse TTTCCTCTGGCAGGCAACCTTATAATTTCATTACGATTT ATGGGAATTAGCCATGGTCC AvrA-q forward AGAGTTATGGACGGAAAGAC AvrA-q reverse AAATACCGCATTCAGAAGAG GMK forward CACTCAGGTTTCCGTTTCA GMK reverse CACTTGCTCAATGGTTTCG mIL-6 forward CTGCAAGAGACTTCCATCCAG mIL-6 reverse AGTGGTATAGACAGGTCTGTTGG hZo-1 reverse TGGTGTCCTACCTAATTCAACTCA hZo-1 forward CGCCAGCTACAA ATATTCCAACA mZo-1 reverse ATCTGGCTCCTCTCTTGCCAACTT mZo-1 forward AGGTCTTCGCAGCTCCAAGAGAAA mTNF-α forward CCCTCACACTCAGATCATCTTCT mTNF-α reverse GCTACGACGTGGGCTACAG Open in a separate window Primers used in this study Cell Culture Human epithelial Caco-2 BBE, HCT116 and SKCO15 cells were maintained in DMEM supplemented with 10% FBS, streptomycin-penicillin, and l -glutamine. .. Biochemical tests were performed using the API 20E identification kit (bioMerieux SA, Lyon, France) in accordance with the manufacturer's protocol. table ft1 table-wrap mode="anchored" t5 TABLE 2 caption a7 Primer Sequence (5′-3′) AvrA-e forward CAGGCCACAAAAGAAAAC AvrA-e reverse ATAACAGCCGCATCAAAC AvrA-r forward CCCAAGCTT ATCTACCTCCCGGTGTCA AvrA-r reverse CGGGATCC TTGCGGGCGTCTATCTGT AvrA-cm forward AGGCAATATATTGAATCTGAAAAGTTAAAGATGATATTT GTGTAGGCTGGAGCTGCTTC AvrA-cm reverse TTTCCTCTGGCAGGCAACCTTATAATTTCATTACGATTT ATGGGAATTAGCCATGGTCC AvrA-q forward AGAGTTATGGACGGAAAGAC AvrA-q reverse AAATACCGCATTCAGAAGAG GMK forward CACTCAGGTTTCCGTTTCA GMK reverse CACTTGCTCAATGGTTTCG mIL-6 forward CTGCAAGAGACTTCCATCCAG mIL-6 reverse AGTGGTATAGACAGGTCTGTTGG hZo-1 reverse TGGTGTCCTACCTAATTCAACTCA hZo-1 forward CGCCAGCTACAA ATATTCCAACA mZo-1 reverse ATCTGGCTCCTCTCTTGCCAACTT mZo-1 forward AGGTCTTCGCAGCTCCAAGAGAAA mTNF-α forward CCCTCACACTCAGATCATCTTCT mTNF-α reverse GCTACGACGTGGGCTACAG Open in a separate window Primers used in this study Cell Culture Human epithelial Caco-2 BBE, HCT116 and SKCO15 cells were maintained in DMEM supplemented with 10% FBS, streptomycin-penicillin, and l -glutamine. .. Cell Treatment with the JNK Inhibitor SP600125 The JNK inhibitor SP600125 (50 m m ; EMD Biosciences, San Diego, CA) was added directly to the culture medium 1 h before Salmonella treatment.

    other:

    Article Title: Community structures and comparison of nosZ and 16S rRNA genes from culturable denitrifying bacteria.
    Article Snippet: The objectives of this study were (i) to isolate and characterize of cultivable denitrifying bacteria using classic microbiological and molecular methods, (ii) to compare of 16S rRNA and nosZ genes as molecular markers, (iii) to determine bacterial community structure and diversity in soil samples using single-strand conformation polymorphism (SSCP) analysis.. In this study, 49 bacterial isolates were cultivated and phylogenetic analyses grouped them into two phyla: Proteobacteria (37 species) and Firmicutes (12 species).. Our study showed that the nosZ functional gen could be used to identify denitrifying bacteria abundance in environment but could not be used to identify pure bacterial cultures.

    Isolation:

    Article Title: Molecular Epidemiological Surveillance of CTX-M-15-producing Klebsiella pneumoniae from the patients of a teaching hospital in Sindh, Pakistan.
    Article Snippet: .. The isolation of bacteria was carried out by conventional bacteriological techniques and identification was confirmed by API 20E identification kit (BioMerieux, France). ..

    Bacteria:

    Article Title: Molecular Epidemiological Surveillance of CTX-M-15-producing Klebsiella pneumoniae from the patients of a teaching hospital in Sindh, Pakistan.
    Article Snippet: .. The isolation of bacteria was carried out by conventional bacteriological techniques and identification was confirmed by API 20E identification kit (BioMerieux, France). ..



    Similar Products

    api 20e identification kit for enterobacterales detection  (bioMerieux gmbh)
    90
    bioMerieux gmbh api 20e identification kit for enterobacterales detection
    Api 20e Identification Kit For Enterobacterales Detection, supplied by bioMerieux gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/api+20e+identification+kit/api+20+e/pmc12218873-93-12-14
    Average 90 stars, based on 1 article reviews
    api 20e identification kit for enterobacterales detection - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    api 20e biochemical identification kit  (Merieux NutriSciences)
    90
    Merieux NutriSciences api 20e biochemical identification kit
    Api 20e Biochemical Identification Kit, supplied by Merieux NutriSciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/api+20e+identification+kit/api20e+system/pm40275422-23-19-27
    Average 90 stars, based on 1 article reviews
    api 20e biochemical identification kit - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    biochemical identification by api 20e kits  (bioMerieux gmbh)
    90
    bioMerieux gmbh biochemical identification by api 20e kits
    Biochemical Identification By Api 20e Kits, supplied by bioMerieux gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/api+20e+identification+kit/api+20e/10__1016_slash_j__molstruc__2024__139990-65-7-15
    Average 90 stars, based on 1 article reviews
    biochemical identification by api 20e kits - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    api 20e/20ne identification kit  (bioMerieux gmbh)
    90
    bioMerieux gmbh api 20e/20ne identification kit
    Api 20e/20ne Identification Kit, supplied by bioMerieux gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/api+20e+identification+kit/api+identification+kits/pmc11224811-173-13-17
    Average 90 stars, based on 1 article reviews
    api 20e/20ne identification kit - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    api 20e microorganism identification kit  (Sysmex Corporation)
    90
    Sysmex Corporation api 20e microorganism identification kit
    Api 20e Microorganism Identification Kit, supplied by Sysmex Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/api+20e+identification+kit/api+20e+kit/pm38430961-45-7-12
    Average 90 stars, based on 1 article reviews
    api 20e microorganism identification kit - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    api 20e identification kit  (bioMerieux gmbh)
    90
    bioMerieux gmbh api 20e identification kit
    Construction of S. Enteritidis ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 deficient mutants and biochemical identification of the deficient strains. (A) Schematic representation of the construction for S. Enteritidis ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 mutants. The Salmonella deficient mutants were produced by using the λ-Red recombinase gene replacement method. (B) All gene deletions were verified by PCR analysis and by sequencing. The stn gene was used as the reference control. (C) Growth curves of S. Enteritidis C50041 wild-type, ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 deletion strains. Bacteria were cultured in LB medium at 37°C with 180 rpm, and the OD 600 values of bacterial cultures were determined in 0.5 h intervals. (D) Biochemical tests of S. Enteritidis WT, ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 strains using the <t>API</t> <t>20E</t> identification kit. Sterile water was used as control.
    Api 20e Identification Kit, supplied by bioMerieux gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/api+20e+identification+kit/api+20e/pmc10266283-55-6-10
    Average 90 stars, based on 1 article reviews
    api 20e identification kit - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    analytical profile index (api) 20e/20ne identification kit  (bioMerieux gmbh)
    90
    bioMerieux gmbh analytical profile index (api) 20e/20ne identification kit
    Construction of S. Enteritidis ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 deficient mutants and biochemical identification of the deficient strains. (A) Schematic representation of the construction for S. Enteritidis ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 mutants. The Salmonella deficient mutants were produced by using the λ-Red recombinase gene replacement method. (B) All gene deletions were verified by PCR analysis and by sequencing. The stn gene was used as the reference control. (C) Growth curves of S. Enteritidis C50041 wild-type, ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 deletion strains. Bacteria were cultured in LB medium at 37°C with 180 rpm, and the OD 600 values of bacterial cultures were determined in 0.5 h intervals. (D) Biochemical tests of S. Enteritidis WT, ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 strains using the <t>API</t> <t>20E</t> identification kit. Sterile water was used as control.
    Analytical Profile Index (Api) 20e/20ne Identification Kit, supplied by bioMerieux gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/api+20e+identification+kit/analytical+profile+index+api/pmc10075463-254-11-18
    Average 90 stars, based on 1 article reviews
    analytical profile index (api) 20e/20ne identification kit - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    Construction of S. Enteritidis ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 deficient mutants and biochemical identification of the deficient strains. (A) Schematic representation of the construction for S. Enteritidis ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 mutants. The Salmonella deficient mutants were produced by using the λ-Red recombinase gene replacement method. (B) All gene deletions were verified by PCR analysis and by sequencing. The stn gene was used as the reference control. (C) Growth curves of S. Enteritidis C50041 wild-type, ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 deletion strains. Bacteria were cultured in LB medium at 37°C with 180 rpm, and the OD 600 values of bacterial cultures were determined in 0.5 h intervals. (D) Biochemical tests of S. Enteritidis WT, ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 strains using the API 20E identification kit. Sterile water was used as control.

    Journal: Frontiers in Cellular and Infection Microbiology

    Article Title: Salmonella Enteritidis activates inflammatory storm via SPI-1 and SPI-2 to promote intracellular proliferation and bacterial virulence

    doi: 10.3389/fcimb.2023.1158888

    Figure Lengend Snippet: Construction of S. Enteritidis ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 deficient mutants and biochemical identification of the deficient strains. (A) Schematic representation of the construction for S. Enteritidis ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 mutants. The Salmonella deficient mutants were produced by using the λ-Red recombinase gene replacement method. (B) All gene deletions were verified by PCR analysis and by sequencing. The stn gene was used as the reference control. (C) Growth curves of S. Enteritidis C50041 wild-type, ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 deletion strains. Bacteria were cultured in LB medium at 37°C with 180 rpm, and the OD 600 values of bacterial cultures were determined in 0.5 h intervals. (D) Biochemical tests of S. Enteritidis WT, ΔSPI-1 , ΔSPI-2 and ΔSPI-1/SPI-2 strains using the API 20E identification kit. Sterile water was used as control.

    Article Snippet: Biochemical tests were performed using an API 20E identification kit (bioMerieux SA, Lyon, France) in accordance with the manufacturer’s protocol.

    Techniques: Produced, Sequencing, Control, Bacteria, Cell Culture, Sterility